Gelsolin alleviates rheumatoid arthritis by negatively regulating NLRP3 inflammasome activation

Mice

The floxed Gsn allele on mouse chromosome 2 was generated by Biotechnology Research and Development, Osaka University, using CRISPR-Cas9 gene editing, according to the following two-step method. Pronuclear-stage zygotes from C57/B6J mice were electroporated with an EcoRV–loxP site-containing single-stranded oligonucleotide (ssODN) and crRNA (AAACGTGATCTACCCTTCTGCAGCC); the latter targets intron 2 of Gsn and the Cas9 protein. Embryos were surgically transplanted into the oviducts of pseudo-pregnant ICR mice. Newborn mice bearing an EcoRV–loxP site in intron 2 were identified by genotyping. Pronuclear-stage zygotes from gene-modified mice were electroporated with a loxP–XhoI site-containing ssODN and another crRNA (CACCGAGGATCTCAGGATCGGGACT) that targets intron 3 of Gsn and the Cas9 protein. The second embryo was transplanted into pseudo-pregnant ICR mice, and newborn mice bearing both the EcoRV–loxP site in intron 2 and the loxP–XhoI site in intron 3 were identified through genotyping. Cre recombination resulted in the deletion of exon 3 of the floxed Gsn allele. Gsn^fl/fl mice were bred with C57/B6-LysM–cre mice (RBRC02302) to generate macrophage-specific Gsn-deficient mice (Gsn^ΔMye) in a specific pathogen-free (SPF) animal facility at Nippon Medical School.

Mice were housed under SPF conditions. Mice (6–10 weeks old) from the same cage were randomly selected for different treatments. Littermate controls were included whenever possible. The experiments were performed on both females and males. The investigators were not blinded, as none of the reported experiments required subjective decision-making. Key experiments were repeated by at least three independent researchers. Primer sequences used for genotyping are listed in Supplementary Table S1.

Cell culture

To generate mouse BMDMs, bone marrow cells were flushed from the femurs and tibias of 6–10-week-old mice using Dulbecco’s phosphate-buffered saline (DPBS). The cells were subsequently cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 20% L929 cell-conditioned medium, and 100 U/mL of penicillin and streptomycin, respectively, for 7 days. To obtain mouse peritoneal-resident macrophages, the peritoneal exudate cells (PECs) were collected by injecting 10 mL of 5 mM ethylenediaminetetraacetic acid-containing PBS into the mouse peritoneal cavities at 6–10 weeks of age. The collected PECs were seeded into cell-culture plates or dishes. After 2 h, the non-attached cells were removed. The macrophages were cultured in DMEM supplemented with 10% FBS, 100 U/mL each of penicillin and streptomycin, and 2 mM L-glutamine. The J774.1 mouse macrophage cell line (RIKEN, Saitama, Japan) was cultured in Roswell Park Memorial Institute (RPMI) 1640 medium supplemented with 10% FBS, 1 mM sodium pyruvate, 2 mM L-glutamine, 100× MEM non-essential amino acids, 100 U/mL each of penicillin and streptomycin, and 50 μM 2-mercaptoethanol. The human embryonic kidney cell line HEK293T was cultured in DMEM supplemented with 10% FBS and 100 U/mL each of penicillin and streptomycin.

Macrophage stimulation

To activate the NLRP3 inflammasome in macrophages, the cells were primed with 500 ng/mL LPS-EK Ultrapure (tlrl-peklps, Invivogen, San Diego, CA, USA) or 100 ng/mL LPS-EB Ultrapure from Escherichia coli 0111:B4 (tlrl-3pelps, Invivogen) in Opti-MEM (31985-070, Thermo Fisher Scientific, Waltham, MA, USA) for 3 h, followed by stimulation with the indicated concentrations of nigericin (tlrl-nig, Invivogen), imiquimod (1338313, Sigma, St. Louis, MO, USA), CPPD crystals (tlrl-cppd, Invivogen), MSU crystals (tlrl-msu, Invivogen), or hydroxyapatite (289396, Sigma) for the indicated time. To activate the AIM2 inflammasome, 0.75 µg/mL poly(dA:dT) (tlrl-patn, Invivogen) was transfected into LPS-primed cells using Lipofectamine 2000 (11668027, Invitrogen, Waltham, MA, USA). To activate the non-canonical inflammasome, 2 µg/mL ultrapure LPS from E. coli 0111:B4 was transfected into LPS-primed cells using FuGENE^® HD (E2311, Promega, Madison, WI, USA). To activate the NLRC4 inflammasome, 1.5 µg/mL flagellin from Salmonella typhimurium (SRP8029; Sigma) was transfected into LPS-primed cells using Lipofectamine 2000 (11668027; Invitrogen). After transfection, the cells were cultured for 2 h.

CRISPR-Cas9 knockout cell clones

Gsn-deficient J774.1 cell clones were generated using CRISPR/Cas9 gene editing technology. The murine Gsn knockout target sites (ACACGTGGTACCCAATGAGGTGG, TCCCGCCAAACAAGCTCATGAGG, and CGCGCTCCACGTTGGCAATGTGG) were identified using the CHOPCHOP website ( The sgRNA for each target site was synthesized using an in vitro transcription kit (EnGen^® sgRNA Synthesis Kit, S. pyogenes [E3322s, NEB, Ipswich, MA, USA]). After dephosphorylation using shrimp alkaline phosphatase (2660 A; Takara, Kusatsu, Japan), the sgRNA was purified using an RNA purification kit (Monarch^® RNA Cleanup Kit [T2040s; NEB]). Next, 500 ng of sgRNAs and 1.5 μg of Cas9 protein (M0646T, NEB) complexes were transfected into 1.7 × 10⁵ J774.1 cells using the TransIT-X2^® reagent (MIR6003, Mirus, Marietta, GA, USA). After 2 days, the cells were seeded into 96-well plates at a concentration of one cell per well. The Gsn-deficient J774.1 cell clone (P18-37) was selected for this study based on the western blotting analysis results. Parental J774.1 cells were used as controls.

Protein identification

BMDMs were stimulated with LPS for 3 h and lysed in ice-cold cell lysis buffer (20 mM HEPES [pH 7.4], 150 mM NaCl, 1.5 mM MgCl_2, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and 0.5% Nonidet P-40) containing protease and phosphatase inhibitor cocktails (Nacalai, Kyoto, Japan). After the cell lysates were centrifuged at 15,000 × g at 4 °C for 10 min, the supernatants were subjected to SDS-PAGE. After staining the gel with the Oriole^® fluorescent gel staining solution (1610496, Bio-Rad, Hercules, CA, USA), the major bands were cut on a UV transilluminator (Analytik Jena GmbH, Jena, Germany). The excised gels were sent to Japan Proteomics (Miyagi, Japan) for protein identification based on nano LC-MS/MS analysis.

Plasmid construction and transfection

The pcDNA3-N-Flag-NLRP3 was purchased from Addgene (75127; Watertown, MA, USA). The DNA fragments encoding murine GSN, ASC, pro-caspase-1, and MAVS were obtained after PCR-based amplification of the cDNA from J774.1 cells. These fragments were subcloned into pcDNA3-6xMyc, pCS4-3xHA, or pcDNA3.1/V5-His A. Truncated mutant constructs of NLRP3 and GSN were generated by subcloning the PCR products from the plasmids expressing full-length NLRP3 and GSN into pcDNA3-N-Flag and pcDNA3-6xMyc, respectively. The constructs were transiently transfected into HEK293T cells for 48 h using Lipofectamine 2000 (11668027; Invitrogen) according to the manufacturer’s instructions. To chelate calcium, 5, 20, and 40 μM of BAPTA-AM (Calbiochem, San Diego, CA, USA) was added during the transfection.

Co-immunoprecipitation (Co-IP)

To perform Co-IP of endogenous proteins, the BMDMs stimulated with LPS for 3 h were lysed in ice-cold cell lysis buffer (20 mM HEPES [pH 7.4], 150 mM NaCl, 1.5 mM MgCl₂, 10 mM KCl, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, and 0.5% Nonidet P-40) containing protease and phosphatase inhibitor cocktails (Nacalai). After the cell lysates were centrifuged at 15,000 × g at 4 °C for 10 min, the supernatants were incubated at 4 °C for 2 h with the anti-NLRP3 antibody (AG-20B-0014, AdipoGen, San Diego, CA, USA), which was conjugated with Dynabeads^® Protein G (Invitrogen). The beads were washed thrice with the lysis buffer. To perform Co-IP of the overexpressed proteins in HEK293T cells, the cells were transfected with the indicated plasmids as described earlier and lysed in ice-cold IP lysis buffer (50 mM HEPES [pH 7.0], 250 mM NaCl, 1 mM EDTA, and 0.2% Nonidet P-40) containing a protease inhibitor cocktail (Bio-Rad). The cell lysates were collected after centrifugation at 14,000 rpm for 15 min. The whole-cell lysates were subsequently incubated overnight with anti-Flag M2 affinity gel (Sigma) or anti-c-Myc agarose conjugate (Sigma) with rotation at 4 °C. The beads were extensively washed thrice with the IP lysis buffer. The immunoprecipitates were eluted with the IP elution buffer (0.1 M glycine HCl, pH 3.5) and neutralized with the IP neutralization buffer (0.5 M Tris HCl [pH 7.4] and 1.5 M NaCl). Both the whole cell lysates and immunoprecipitates were subjected to immunoblotting.

In situ proximity ligation assay

The cells were seeded onto Lab-Tek^® II CC2^® eight-well chamber slides (154941PK; Thermo Fisher), stimulated with 100 ng/mL LPS for 3 h, fixed in 2% paraformaldehyde, and permeabilized 0.5% Triton X-100. Next, the cells were incubated for 17 h at 4 °C with the following antibodies: anti-GSN (12953, CST, Danvers, MA, USA), anti-NLRP3 (AG-20B-0014, AdipoGen), anti-MFN2 (9482, CST), and anti-MAVS (4983, CST). The cells were washed and allowed to react with a pair of Duolink proximity probes (Olink Bioscience, Uppsala, Sweden). The nuclei were counterstained with Hoechst 34580. Confocal images were acquired using a Zeiss LSM 980 laser scanning microscope (Carl Zeiss, Jena, Germany).

Gel filtration chromatography

The BMDMs were primed with LPS with or without subsequent stimulation with nigericin. The cells were lysed in ice-cold NP-40 lysis buffer (50 mM Tris-HCl [pH 7.4], 1% NP-40, and 150 mM NaCl) containing a protease inhibitor cocktail (Bio-Rad) and centrifuged at 14,000 rpm for 15 min. Fresh soluble lysate containing 2.5 mg of total protein was loaded onto an XK 16/70 column packed with Superdex 200 prep-grade resin (Cytiva, Marlborough, MA, USA). The proteins were fractionated using an ÄKTA Pure Protein Purification System (Cytiva) in a buffer containing 20 mM sodium phosphate and 150 mM NaCl at pH 7.0. Each 5 mL fraction was collected and concentrated using an Amicon ultra centrifugal filter, and the concentrated samples were subjected to immunoblotting analysis.

Immunoblotting analysis

Cells were lysed in RIPA buffer (CST) supplemented with a protease inhibitor cocktail (Bio-Rad). The whole cell lysates were collected through centrifugation at 14,000 rpm for 15 min. The proteins were quantified using the BCA assay (Pierce, Waltham, MA, USA). The proteins were separated using sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and equal quantities of each protein were transferred onto nitrocellulose membranes. The membranes were probed with specific primary antibodies, followed by incubation with the corresponding secondary HRP-conjugated antibodies. The proteins were visualized using an ECL detection reagent (GE HealthCare, Chicago, IL, USA) and a luminescent image analyzer (ImageQuant LAS 4000). For protein precipitation from the cell culture supernatant, equal volumes of methanol and one-fourth volume of chloroform were added to the supernatant, followed by thorough mixing by vortexing and centrifugation at 13,000 rpm for 5 min. The upper aqueous phase was discarded, and an equal volume of methanol was added to each sample. After centrifugation at 13,000 rpm for 5 min, the protein pellet was dried at 55 °C and boiled in 1× SDS buffer containing 0.1 M DTT. Mouse plasma samples were boiled in 1× SDS buffer, and 5 μL of each plasma sample was equally loaded onto sodium dodecyl sulfate-polyacrylamide gel. The following antibodies were used: anti-NLRP3 (AG-20B-0014, AdipoGen), anti-GSN (12953, CST), anti-pGSN (ab75832, Abcam, Cambridge, UK), anti-ASC (AG-25B-0006, AdipoGen), anti-IL-1β (AF-401-NA, R&D systems, Minneapolis, MN, USA), anti-caspase-1 (AG-20B-0042, AdipoGen), caspase-11 (ab180673, Abcam, Cambridge, UK), anti-β-actin (4967, CST), anti-GAPDH (sc-25778, Santa Cruz, Dallas, TX, USA), anti-acetylated-α-tubulin (sc-23950, Santa Cruz), anti-p65 (8242, CST), anti-IκBα (ab32518, Abcam), anti-phospho-IκBα (9246, CST), anti-GSDMD (ab209845, Abcam), anti-TOMM20 (ab56783, Abcam), anti-α-tubulin (E12-054, EnoGene, New York, NY, USA), anti-TSG101 (ab125011, Abcam), anti-Flag (F7425, Sigma), anti-Flag (F1804, Sigma), anti-Myc (C3956, Sigma), anti-HA (11867423001, Roche, Basel, Switzerland), and anti-His (ab9108, Abcam). All primary antibodies were diluted in a 1:1000 ratio.

Elisa

The cytokines concentrations in the cell culture supernatants, peritoneal lavage fluid, and plasma were measured using ELISA kits for mouse IL-1β (BioLegend, San Diego, CA, USA), mouse IL-18 (Invitrogen), mouse tumor necrosis factor alpha (TNFα) (BioLegend), and mouse GSN (ABclonal, Woburn, MA, USA), according to the manufacturer’s instructions.

RNA isolation and quantitative real-time PCR

Total RNA was extracted using the TRIzol reagent (Invitrogen), and cDNA was synthesized by reverse transcription of 2 μg of RNA. Quantitative real-time PCR was performed using SYBR Green (Invitrogen) and detected on a LightCycler480 II (LC480; Roche) under the following cycling conditions: pre-incubation at 95 °C for 5 min, followed by 45 cycles of amplification at 95 °C for 10 s, 60 °C for 10 s, and 72 °C for 10 s. Gapdh was used as the internal control, and the relative gene expression was calculated using the 2^−∆∆Ct method. Specific primer sequences used for qRT-PCR are listed in the supplementary Table S1.

Cytotoxicity assay

An LDH cytotoxicity assay kit (DoGenBio, Seoul, Korea) was used according to the manufacturer’s instructions to determine the release of lactate dehydrogenase (LDH) into the culture medium after NLRP3 inflammasome activation. For real-time cell death analysis, the LPS-primed cells were seeded into a 96-well plate at a density of 0.5 × 10⁵ cells/well. After stimulation with 5 μM nigericin and staining with Cytotox Green, the cells were imaged every 20 min for 3 h using an IncuCyte Live-Cell Analysis System (Sartorius, Göttingen, Germany).

ASC oligomerization assay

Cells were lysed with PBS containing 0.5% Triton X-100 and a protease inhibitor cocktail (Bio-Rad), followed by centrifugation at 6000 × g for 15 min. The Triton X-100 soluble supernatant was collected, whereas the Triton X-100 insoluble pellet was washed twice with PBS and cross-linked at 37 °C for 30 min in PBS containing 2 mM disuccinimidyl suberate (Thermo Fisher Scientific) and a protease inhibitor cocktail (Bio-Rad). The cross-linked pellet was dissolved in 1× SDS buffer and boiled. The Triton X-100 soluble and insoluble fractions were subjected to immunoblotting analysis.

Reconstitution of the NLRP3 inflammasome system in HEK293T cells

HEK293T cells were plated into 6-well plates at a density of 1.8 × 10⁶ cells/well and transfected with plasmids expressing Myc-GSN (500 ng), HA-ASC (350 ng), Flag-NLRP3 (350 ng), and Pro-caspase-1-V5 (1 μg) using Lipofectamine 2000 (11668027, Invitrogen). After 48 h, the cells were stimulated with nigericin (20 μM for 45 min), and cleaved pro-caspase-1 was assessed using immunoblotting analysis.

Subcellular fractionation

Cytosolic and mitochondrial fractions were obtained for cultured cells (Thermo Fisher Scientific) using a mitochondrial isolation kit by following the manufacturer’s protocol. Each fraction was analyzed using immunoblotting and verified using anti-TOMM20 and anti-α-tubulin antibodies.

Immunofluorescence cell staining

Cells were seeded onto Lab-Tek^® II CC2^® eight-well chamber slides (Thermo Fisher Scientific) and stimulated with 100 ng/mL LPS for 3 h. For some experiments, the LPS-primed macrophages were stimulated with nigericin (5 μM) for 15 min. Then, the cells were fixed in 2% paraformaldehyde and permeabilized in 0.5% Triton X-100. Subsequently, the cells were incubated for 17 h at 4 °C with the following primary antibodies: anti-NLRP3 (AG-20B-0014, AdipoGen), anti-MAVS (4983, CST), anti-ASC (67824), and anti-GRP78 (11587-1-AP, Proteintech). Next, the cells were incubated for 40 min at room temperature with the following secondary antibodies: Alexa Fluor 488-conjugated anti-rabbit IgG pAb (A11070; Invitrogen) and Alexa Fluor 546-conjugated anti-mouse IgG pAb (A11018, Invitrogen). For some experiments, the mitochondria were labeled with MitoSpy^® Orange CMTMRos (424803, BioLegend) and the nuclei were counterstained with Hoechst 34580. Confocal images were acquired using a Zeiss LSM 980 laser scanning microscope (Carl Zeiss) and analyzed using the Zen software (Carl Zeiss).

Quantification of intracellular calcium

For intracellular calcium analysis using a microplate reader, LPS-primed peritoneal-resident macrophages were plated into 96-well black plates with a clear bottom at a density of 1 × 10⁵ cells/well. The cells were stained with 1 μM Fluo-4 AM (Invitrogen) for 30 min. The cells were stimulated with 20 μM nigericin, 1 mM CaCl₂, and 5 μM ionomycin at the indicated times. Fluorescence was read for 30 min at 15 s intervals using the FLUOstar Omega microplate reader at 485 nm excitation and 520 nm emission wavelengths. For intracellular calcium analysis using confocal microscopy, LPS-primed peritoneal resident macrophages were plated onto 8-well chambered coverslips (Thermo Fisher Scientific) at a density of 1 × 10⁶ cells/well and stained with 5 μM Fluo-4 AM (Invitrogen) for 30 min. Images of untreated cells were acquired (t = 0). Subsequently, the cells were stimulated with 20 μM nigericin or 1 mM CaCl₂ and imaged for 30 min at 15 s intervals. After 30 min, 5 μM ionomycin was added to the cells, and the cells were imaged for 10 min at 15 s intervals. Fluorescence images were obtained using a Zeiss LSM 980 laser scanning microscope (Carl Zeiss) with a 488 nm laser and emission at 525 nm. The images were analyzed using the Imaris software (Andor Technology, Belfast, Northern Ireland).

Mitochondrial function assays

To measure mitochondrial damage, the cells were co-stained with 200 nM MitoTracker Green (Invitrogen) and 200 nM MitoTracker Deep Red (Invitrogen) for 30 min. After washing twice with PBS, the cells were resuspended in PBS and subjected to flow cytometric analysis using an LSRFortessa X-20 flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). To measure mitochondrial ROS production, the cells were stained with 5 μM MitoSOX Red (Invitrogen) for 15 min. After washing twice with PBS, the cells were resuspended in PBS and subjected to flow cytometric analysis using an LSRFortessa X-20 flow cytometer (BD Biosciences).

Transmission electron microscopy (TEM)

Specimens were fixed in a solution containing 2% glutaraldehyde and 2% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) for 12 h. Subsequently, the specimens were washed in 0.1 M phosphate buffer, post-fixed with 1% OsO₄ in 0.1 M phosphate buffer for 2 h, and dehydrated with an ascending series of ethanol (50%, 60%, 70%, 80%, 90%, 95%, and 100%) for 10 min each. Next, the specimens were incubated with propylene oxide for 10 min, embedded with a Poly/Bed 812 kit (Polysciences, Warrington, PA, USA), and polymerized in an electron microscope oven (TD-700, Dosaka, Kyoto, Japan) at 65 °C for 12 h. The resulting block was sliced (200-nm semi-thin sections) with a diamond knife in an ultramicrotome and stained with toluidine blue for observation under an optical microscope. The region of interest was subsequently cut into 80-nm thin sections using an ultramicrotome, placed on copper grids, double-stained with 5% uranyl acetate for 20 min and 3% lead citrate for 7 min, and imaged using a transmission electron microscope (HT7800; Hitachi, Tokyo, Japan) equipped with an RC10 CMOS camera at an acceleration voltage of 80 kV.

Flow cytometry

The PECs were stained with PerCP-Cyanine5.5-anti-CD11b Invitrogen BV421-anti-CD11b (BioLegend), BV786-anti-CD11c (BioLegend), BV605-anti-CD19 (BioLegend), FITC-anti-Ly6C (BD Biosciences), APC-anti-Ly6G (Invitrogen), YG-PE-anti-F4/80 (BioLegend), and 7-AAD (BioLegend), followed by flow cytometry using an LSRFortessa X-20 (BD Biosciences) instrument. The data were analyzed using the FlowJo software (BD Biosciences).

Exosome isolation

To purify the exosomes, BMDMs were cultured in media supplemented with 10% exosome-free FBS and ultracentrifuged at 100,000 × g for 24 h. After priming with LPS and stimulation with nigericin, the exosomes were isolated from the cell culture supernatant using Total Exosome Isolation Reagent (4478359, Thermo Fisher Scientific) by following the manufacturer’s instructions. Then, the exosome samples were subjected to immunoblotting analysis.

Adjuvant-induced arthritis

Male mice aged 6–10 weeks were intradermally injected on day 0 with 100 µL of either complete Freund’s adjuvant (2 mg/mL of heat-killed Mycobacterium tuberculosis, Chondrex, Woodinville, WA, USA) or incomplete Freund’s adjuvant (control, Chondrex). Arthritic severity and the diameters of the ankle and sole to instep were measured and scored daily. Arthritic severity was graded from 0 to 4, as previously described (Moudgil, Diversification of T cells). On day 8, both paws and plasma samples were collected for hematoxylin and eosin (H&E) staining, immunoblotting analysis, and ELISA.

MSU-induced peritonitis

Male mice aged 6–10 weeks were intraperitoneally injected with 1 mg of either MSU crystals (Invivogen) dissolved in sterile PBS or sterile PBS as the control. After 6 h, the peritoneal cavities were washed with 10 mL of sterile PBS, and the peritoneal lavage fluid was collected. The supernatants were concentrated using an Amicon ultra centrifugal filter, followed by the assessment of the cytokine levels using ELISA. The PECs were analyzed using fluorescence-activated cell sorting (FACS) to determine immune cell infiltration.

Folic acid-induced acute tubular necrosis

Male mice aged 6–10 weeks were intraperitoneally injected with 250 mg/kg folic acid (Sigma) dissolved in 150 mM sodium bicarbonate. After 40 h, the mice were weighed and euthanized through CO₂ asphyxiation. Blood samples were collected via cardiac puncture, and the kidneys were flushed with PBS prior to removal. Blood urea nitrogen (BUN) concentrations in serum samples were determined using a BUN colorimetric detection kit (K024-H1, Arbor Assays, Ann Arbor, MI, USA).

LPS-induced septic shock

Male mice aged 6–10 weeks were intraperitoneally injected with 20 mg/kg LPS (E. coli O111:B4; Sigma) or the same volume of sterile PBS (control). After 3 h, the plasma and peritoneal lavage fluid were collected. The peritoneal lavage fluid was concentrated using an Amicon Ultra centrifugal filter, and both plasma and peritoneal lavage fluid samples were analyzed using ELISA. For the survival test, mice were intraperitoneally injected with 10 mg/kg of LPS (E. coli O111:B4; Sigma) or PBS (control). The mice were monitored every 6 h for 96 h.

Histology

Sagittally transected kidneys were fixed with 4% paraformaldehyde in PBS at 4 °C for 16 h, followed by continuous immersion in 10% sucrose in PBS at 4 °C for 5 h and 20% sucrose in PBS at 4 °C for 16 h. The samples were embedded in OCT compound (Sakura Finetek, Torrance, CA, USA) and stored at −80 °C. The frozen sections (8-mm thick) were subjected to immunofluorescence staining and H&E staining. For immunofluorescence staining, the sections were incubated for 17 h at 4 °C with the following primary antibodies: anti-Ly-6G (127601, BioLegend) and anti-F4/80 (Ab00106-2.3, Absolute Antibody, Oxford, UK). Then, they were stained with Alexa Fluor 488-conjugated anti-rat IgG pAb (A11006, Invitrogen) and Alexa Fluor 546-conjugated anti-mouse IgG pAb (A11018, Invitrogen) for 40 min at room temperature (RT). The nuclei were counterstained with Hoechst 34580. Confocal images were acquired using a Zeiss LSM 980 laser scanning microscope (Carl Zeiss) and analyzed using Zen software (Carl Zeiss). The sections were stained with Mayer’s hematoxylin and eosin (Sakura Finetek).

Analysis of nanopore long read sequencing data

The nanopore reads were retrieved and explored via the UCSC Genome Browser platform. The expression ratio of cGSN and pGSN transcripts was calculated by referencing the gene annotations provided by GENCODE Release M34. The analysis focused on distinguishing cGSN and pGSN the transcripts based on their annotated genomic coordinates and using the isoform-specific sequence features.

Quantification and Statistical Analysis

All data were analyzed using GraphPad Prism 5 (GraphPad Software, Inc., La Jolla, CA, USA). The data are presented as mean ± SD or mean ± SEM. Statistical significance was evaluated using a two-tailed Student’s t test or Two-way ANOVA followed by additional validation using Bonferroni method. For the survival analysis, statistical significance was assessed using the log-rank test. P